Searching for a pattern
Let's find some occurrences of a pattern in the zikaVirus set using vmatchPattern(). Then, let's try the same pattern search using matchPattern() with a single sequence, zikv.
# For Sets
vmatchPattern(pattern = "ACATGGGCCTACCATGGGAG",
subject = zikaVirus, max.mismatch = 1)
# For single sequences
matchPattern(pattern = "ACATGGGCCTACCATGGGAG",
subject = zikv, max.mismatch = 1)
Both functions should find the same number of occurrences, but you will notice a different output. How many matches do we get when running each pattern search individually?
Questo esercizio fa parte del corso
Introduction to Bioconductor in R
Esercizio pratico interattivo
Passa dalla teoria alla pratica con uno dei nostri esercizi interattivi
Inizia esercizio