BaşlayınÜcretsiz başlayın

Searching for a pattern

Let's find some occurrences of a pattern in the zikaVirus set using vmatchPattern(). Then, let's try the same pattern search using matchPattern() with a single sequence, zikv.

# For Sets
vmatchPattern(pattern = "ACATGGGCCTACCATGGGAG", 
              subject = zikaVirus, max.mismatch = 1)
# For single sequences
matchPattern(pattern = "ACATGGGCCTACCATGGGAG", 
              subject = zikv, max.mismatch = 1)

Both functions should find the same number of occurrences, but you will notice a different output. How many matches do we get when running each pattern search individually?

Bu egzersiz, kursun bir parçasıdır

Introduction to Bioconductor in R

Kursa Göz Atın

Uygulamalı etkileşimli egzersiz

Teoriyi etkileşime dönüştürün, interaktif egzersizlerimizden biriyle

Egzersize başla